eeglab open-source matlab r 2015a toolbox Search Results


software and algorithms presentation  (neurobehavioral systems inc)
90
neurobehavioral systems inc software and algorithms presentation
KEY <t> RESOURCE </t> TABLE
Software And Algorithms Presentation, supplied by neurobehavioral systems inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/eeglab+open-source+matlab+r+2015a+toolbox/software+and+algorithms+presentation/pmc06286091-550-55-62
Average 90 stars, based on 1 article reviews
software and algorithms presentation - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
image acquisition image processing toolboxes release 2015a  (MathWorks Inc)
96
MathWorks Inc image acquisition image processing toolboxes release 2015a
KEY RESOURCES TABLE
Image Acquisition Image Processing Toolboxes Release 2015a, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/eeglab+open-source+matlab+r+2015a+toolbox/Image+Processing+Toolbox/pmc06876991-519-151-158
Average 96 stars, based on 1 article reviews
image acquisition image processing toolboxes release 2015a - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier
estradiol elisa kit  (Arbor Assays)
90
Arbor Assays estradiol elisa kit
KEY RESOURCES TABLE
Estradiol Elisa Kit, supplied by Arbor Assays, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/eeglab+open-source+matlab+r+2015a+toolbox/estradiol+elisa+kit/pmc06876991-519-54-58
Average 90 stars, based on 1 article reviews
estradiol elisa kit - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
creatinine urinary detection kit  (Arbor Assays)
90
Arbor Assays creatinine urinary detection kit
KEY RESOURCES TABLE
Creatinine Urinary Detection Kit, supplied by Arbor Assays, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/eeglab+open-source+matlab+r+2015a+toolbox/detect+x+serum+creatinine+detection+kit/pmc06876991-519-66-69
Average 90 stars, based on 1 article reviews
creatinine urinary detection kit - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
progesterone elisa kit  (Arbor Assays)
90
Arbor Assays progesterone elisa kit
KEY RESOURCES TABLE
Progesterone Elisa Kit, supplied by Arbor Assays, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/eeglab+open-source+matlab+r+2015a+toolbox/progesterone+elisa+kit/pmc06876991-519-61-64
Average 90 stars, based on 1 article reviews
progesterone elisa kit - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


KEY RESOURCE TABLE

Journal: Neuron

Article Title: Neural mechanisms of sustained attention are rhythmic

doi: 10.1016/j.neuron.2018.07.032

Figure Lengend Snippet: KEY RESOURCE TABLE

Article Snippet: Subsequently, we combined z-scores across observers and then turned the averaged z-scores into a probability using the cumulative distribution function φ according to the following formula: p combined = 1 − φ ( ∑ i = 1 : N φ − 1 1 − p i N ) table ft1 table-wrap mode="anchored" t5 REAGENT or RESOURCE SOURCE IDENTIFIER Software and Algorithms Presentation Neurobehavioral Systems Inc. https://www.neurobs.com EPrime Psychology Software Tools Inc. https://pstnet.com/ MATLAB 2015a MathWorks Inc. RRID: SCR_001622 EEGLAB 13_4_4b ( Delorme and Makeig, 2004 ) https://sccn.ucsd.edu/eeglab/index.php FieldTrip 20170912 ( Oostenveld et al., 2011 ) http://www.fieldtriptoolbox.org/ CircStat 2012 ( Berens, 2009 ) https://philippberens.wordpress.com/code/circstats/ IRASA ( Wen and Liu, 2016 ) https://purr.purdue.edu/publications/1987/1 SPM8 ( Penny et al., 2011 ) http://www.fil.ion.ucl.ac.uk/spm/ Freesurfer 5.3.0 ( Dale et al., 1999 ) https://surfer.nmr.mgh.harvard.edu/ ibootci Andrew Penn; MATLAB central https://mathworks.com/matlabcentral/fileexchange/52741-ibootci Open in a separate window KEY RESOURCE TABLE We furthermore used Pearson’s correlation coefficient to delineate functional networks ( / ).

Techniques: Software

KEY RESOURCES TABLE

Journal: Cell reports

Article Title: A Microglia Sublineage Protects from Sex-Linked Anxiety Symptoms and Obsessive Compulsion

doi: 10.1016/j.celrep.2019.09.045

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-RFP Rockland Cat#600-401-379; RRID:AB_2209751 anti-lba1 Wako Cat#019–19741; RRID:AB_839504 Alexa Fluor 555 Invitrogen Cat#A31572; RRID:AB_162543 anti CD11b-APC BioLegend Cat#101212; RRID: AB_312795 anti CD45-FITC BioLegend Cat#103108; RRID: AB_312973 Chemicals, Peptides, and Recombinant Proteins Urocortin II Millipore-Sigma Cat# U9507 Trilostane Millipore-Sigma Cat#SML0141 Estrogen Millipore-Sigma Cat#PHR1353 Progesterone Millipore-Sigma Cat#P3972 Critical Commercial Assays Cortisol ELISA Kit Arbor Assays Cat#K003 Estradiol ELISA Kit Arbor Assays Cat#K030 Progesterone ELISA Kit Arbor Assays Cat#K025 Creatinine Urinary Detection Kit Arbor Assays Cat#K002 Deposited Data raw and analyzed data This paper N/A Experimental Models: Organisms/Strains Hoxb8 ko Mario Capecchi RRID 4818890 Hoxb8 IRES-Cre Mario Capecchi RRID 4837097 Hoxb8 mut-IRES-Cre This paper N/A Csf1r flox The Jackson Laboratory Stock# 021212; RRID 3653677 Rosa26 lsl-tdTomato The Jackson Laboratory Stock# 007914; RRID 4436847 Oligonucleotides Hoxb8 mut-IRES-Cre genotyping primer: gccagacctacagtcgctacca (forward) This paper N/A Hoxb8 mut-IRES-Cre genotyping primer: cttcttgtcacccttctgcgcatcg (reverse) This paper N/A Software and Algorithms MATLAB and Image Acquisition/Image Processing Toolboxes Release 2015a The MathWorks, Inc. https://www.mathworks.com/products/get-matlab.html?s_tid=gn_getml Leica Application Suite X Leica Microsystems https://www.leica-microsystems.com/products/microscope-software/p/leica-las-x-ls/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FlowJo FlowJo, LLC https://www.flowjo.com/solutions/flowjo/downloads GraphPad Prism version 8.0.0 GraphPad Software https://www.graphpad.com Open in a separate window KEY RESOURCES TABLE A microglia sublineage derived from Hoxb8-expressing precursors serves unique functions Dysfunction of Hoxb8-lineage microglia causes anxiety symptoms and obsessive compulsion Female sex hormones worsen the pathology caused by Hoxb8-lineage microglia dysfunction

Techniques: Recombinant, Enzyme-linked Immunosorbent Assay, Software

KEY RESOURCES TABLE

Journal: Cell reports

Article Title: A Microglia Sublineage Protects from Sex-Linked Anxiety Symptoms and Obsessive Compulsion

doi: 10.1016/j.celrep.2019.09.045

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-RFP Rockland Cat#600-401-379; RRID:AB_2209751 anti-lba1 Wako Cat#019–19741; RRID:AB_839504 Alexa Fluor 555 Invitrogen Cat#A31572; RRID:AB_162543 anti CD11b-APC BioLegend Cat#101212; RRID: AB_312795 anti CD45-FITC BioLegend Cat#103108; RRID: AB_312973 Chemicals, Peptides, and Recombinant Proteins Urocortin II Millipore-Sigma Cat# U9507 Trilostane Millipore-Sigma Cat#SML0141 Estrogen Millipore-Sigma Cat#PHR1353 Progesterone Millipore-Sigma Cat#P3972 Critical Commercial Assays Cortisol ELISA Kit Arbor Assays Cat#K003 Estradiol ELISA Kit Arbor Assays Cat#K030 Progesterone ELISA Kit Arbor Assays Cat#K025 Creatinine Urinary Detection Kit Arbor Assays Cat#K002 Deposited Data raw and analyzed data This paper N/A Experimental Models: Organisms/Strains Hoxb8 ko Mario Capecchi RRID 4818890 Hoxb8 IRES-Cre Mario Capecchi RRID 4837097 Hoxb8 mut-IRES-Cre This paper N/A Csf1r flox The Jackson Laboratory Stock# 021212; RRID 3653677 Rosa26 lsl-tdTomato The Jackson Laboratory Stock# 007914; RRID 4436847 Oligonucleotides Hoxb8 mut-IRES-Cre genotyping primer: gccagacctacagtcgctacca (forward) This paper N/A Hoxb8 mut-IRES-Cre genotyping primer: cttcttgtcacccttctgcgcatcg (reverse) This paper N/A Software and Algorithms MATLAB and Image Acquisition/Image Processing Toolboxes Release 2015a The MathWorks, Inc. https://www.mathworks.com/products/get-matlab.html?s_tid=gn_getml Leica Application Suite X Leica Microsystems https://www.leica-microsystems.com/products/microscope-software/p/leica-las-x-ls/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FlowJo FlowJo, LLC https://www.flowjo.com/solutions/flowjo/downloads GraphPad Prism version 8.0.0 GraphPad Software https://www.graphpad.com Open in a separate window KEY RESOURCES TABLE A microglia sublineage derived from Hoxb8-expressing precursors serves unique functions Dysfunction of Hoxb8-lineage microglia causes anxiety symptoms and obsessive compulsion Female sex hormones worsen the pathology caused by Hoxb8-lineage microglia dysfunction

Techniques: Recombinant, Enzyme-linked Immunosorbent Assay, Software

KEY RESOURCES TABLE

Journal: Cell reports

Article Title: A Microglia Sublineage Protects from Sex-Linked Anxiety Symptoms and Obsessive Compulsion

doi: 10.1016/j.celrep.2019.09.045

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-RFP Rockland Cat#600-401-379; RRID:AB_2209751 anti-lba1 Wako Cat#019–19741; RRID:AB_839504 Alexa Fluor 555 Invitrogen Cat#A31572; RRID:AB_162543 anti CD11b-APC BioLegend Cat#101212; RRID: AB_312795 anti CD45-FITC BioLegend Cat#103108; RRID: AB_312973 Chemicals, Peptides, and Recombinant Proteins Urocortin II Millipore-Sigma Cat# U9507 Trilostane Millipore-Sigma Cat#SML0141 Estrogen Millipore-Sigma Cat#PHR1353 Progesterone Millipore-Sigma Cat#P3972 Critical Commercial Assays Cortisol ELISA Kit Arbor Assays Cat#K003 Estradiol ELISA Kit Arbor Assays Cat#K030 Progesterone ELISA Kit Arbor Assays Cat#K025 Creatinine Urinary Detection Kit Arbor Assays Cat#K002 Deposited Data raw and analyzed data This paper N/A Experimental Models: Organisms/Strains Hoxb8 ko Mario Capecchi RRID 4818890 Hoxb8 IRES-Cre Mario Capecchi RRID 4837097 Hoxb8 mut-IRES-Cre This paper N/A Csf1r flox The Jackson Laboratory Stock# 021212; RRID 3653677 Rosa26 lsl-tdTomato The Jackson Laboratory Stock# 007914; RRID 4436847 Oligonucleotides Hoxb8 mut-IRES-Cre genotyping primer: gccagacctacagtcgctacca (forward) This paper N/A Hoxb8 mut-IRES-Cre genotyping primer: cttcttgtcacccttctgcgcatcg (reverse) This paper N/A Software and Algorithms MATLAB and Image Acquisition/Image Processing Toolboxes Release 2015a The MathWorks, Inc. https://www.mathworks.com/products/get-matlab.html?s_tid=gn_getml Leica Application Suite X Leica Microsystems https://www.leica-microsystems.com/products/microscope-software/p/leica-las-x-ls/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FlowJo FlowJo, LLC https://www.flowjo.com/solutions/flowjo/downloads GraphPad Prism version 8.0.0 GraphPad Software https://www.graphpad.com Open in a separate window KEY RESOURCES TABLE A microglia sublineage derived from Hoxb8-expressing precursors serves unique functions Dysfunction of Hoxb8-lineage microglia causes anxiety symptoms and obsessive compulsion Female sex hormones worsen the pathology caused by Hoxb8-lineage microglia dysfunction

Techniques: Recombinant, Enzyme-linked Immunosorbent Assay, Software

KEY RESOURCES TABLE

Journal: Cell reports

Article Title: A Microglia Sublineage Protects from Sex-Linked Anxiety Symptoms and Obsessive Compulsion

doi: 10.1016/j.celrep.2019.09.045

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-RFP Rockland Cat#600-401-379; RRID:AB_2209751 anti-lba1 Wako Cat#019–19741; RRID:AB_839504 Alexa Fluor 555 Invitrogen Cat#A31572; RRID:AB_162543 anti CD11b-APC BioLegend Cat#101212; RRID: AB_312795 anti CD45-FITC BioLegend Cat#103108; RRID: AB_312973 Chemicals, Peptides, and Recombinant Proteins Urocortin II Millipore-Sigma Cat# U9507 Trilostane Millipore-Sigma Cat#SML0141 Estrogen Millipore-Sigma Cat#PHR1353 Progesterone Millipore-Sigma Cat#P3972 Critical Commercial Assays Cortisol ELISA Kit Arbor Assays Cat#K003 Estradiol ELISA Kit Arbor Assays Cat#K030 Progesterone ELISA Kit Arbor Assays Cat#K025 Creatinine Urinary Detection Kit Arbor Assays Cat#K002 Deposited Data raw and analyzed data This paper N/A Experimental Models: Organisms/Strains Hoxb8 ko Mario Capecchi RRID 4818890 Hoxb8 IRES-Cre Mario Capecchi RRID 4837097 Hoxb8 mut-IRES-Cre This paper N/A Csf1r flox The Jackson Laboratory Stock# 021212; RRID 3653677 Rosa26 lsl-tdTomato The Jackson Laboratory Stock# 007914; RRID 4436847 Oligonucleotides Hoxb8 mut-IRES-Cre genotyping primer: gccagacctacagtcgctacca (forward) This paper N/A Hoxb8 mut-IRES-Cre genotyping primer: cttcttgtcacccttctgcgcatcg (reverse) This paper N/A Software and Algorithms MATLAB and Image Acquisition/Image Processing Toolboxes Release 2015a The MathWorks, Inc. https://www.mathworks.com/products/get-matlab.html?s_tid=gn_getml Leica Application Suite X Leica Microsystems https://www.leica-microsystems.com/products/microscope-software/p/leica-las-x-ls/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FlowJo FlowJo, LLC https://www.flowjo.com/solutions/flowjo/downloads GraphPad Prism version 8.0.0 GraphPad Software https://www.graphpad.com Open in a separate window KEY RESOURCES TABLE A microglia sublineage derived from Hoxb8-expressing precursors serves unique functions Dysfunction of Hoxb8-lineage microglia causes anxiety symptoms and obsessive compulsion Female sex hormones worsen the pathology caused by Hoxb8-lineage microglia dysfunction

Techniques: Recombinant, Enzyme-linked Immunosorbent Assay, Software